Composition and Tm
The Analyze &emdash; Composition and Tm command displays the base composition and melting temperature of the selected Upper or Lower Primer, Current Oligo, active sequence, or PCR product at various salt, nucleic acid, and formamide concentrations. Molecular weights, absorption data, and the Tms of mismatched oligos are also displayed. The analysis of an alternative universal primer, 5'ACTCACTATAGGGCGAATTGG3' is shown below.